IRIX (gcg2) login: petang Password: IRIX Release 6.4 IP27 gcg2 Copyright 1987-1997 Silicon Graphics, Inc. All Rights Reserved. Last login: Mon Nov 6 20:31:36 CST 2000 by UNKNOWN@210.208.177.74 You have mail. ********************************************************************** * WELCOME TO THE NHRI GCG SERVER ! * * * * * * Type go to start the GCG Package ! * * === * * * * Type gcgm to start the manual driven GCG Package ! * * === * * * * Online help: % genhelp or http://gcg.nhri.org.tw * * * * problem report by email: gcg@nhri.org.tw * * * ********************************************************************** gcg2 1% go Welcome to the WISCONSIN PACKAGE Version 10.1-UNIX Installed on irix Copyright (c) 1982-2000, Genetics Computer Group, Inc. A wholly owned subsidiary of Oxford Molecular Group, Inc. All rights reserved. Published research assisted by this software should cite: Wisconsin Package Version 10.1, Genetics Computer Group (GCG), Madison, Wisc. Databases available: GenBank Release 118.0 (06/2000) EMBL (Abridged) Release 62.0 (03/2000) PIR-Protein Release 65.0 (06/2000) NRL_3D Release 27.0 (03/2000) SWISS-PROT Release 39.0 (06/2000) SP-TREMBL Release 14.0 (06/2000) PROSITE Release 16.0 (07/1999) Restriction Enzymes (REBASE) (06/2000) Technical support: phone (608) 231-5200 or e-mail Help@GCG.Com Online help: % genhelp or http://www.gcg.com/genhelp/ GCG System Support Environment Initialized. gcg2 2% cd TEMP gcg2 3% ls M13R.txt lookup.list synpbr322.mapplot enzyme.dat pir.strings z18853.gb_in1 gb.strings swissprot.strings z18853.map gcg2 4% map z18853.gb_in1 Map maps a DNA sequence and displays both strands of the mapped sequence with restriction enzyme cut points above the sequence and protein translations below. Map can also create a peptide map of an amino acid sequence. Begin (* 1 *) ? End (* 1144 *) ? *** I read your enzyme data file "enzyme.dat"!! *** Select the enzymes: Type nothing or "*" to get all enzymes. Type "?" for help on which enzymes are available and how to select them. Enzyme(* * *): What protein translations do you want: a) frame 1 b) frame 2 c) frame 3 d) frame 4 e) frame 5 f) frame 6 t)hree forward frames s)ix frames o)pen frames only n)o protein translation q)uit Please select (capitalize for 3-letter) (* t *): n What should I call the output file (* z18853.map *) ? Mapping ........... Writing . *** ERROR, alpha-TIF_CS shown as "pha-TIF_CS" at position 61! *** . *** ERROR, undefined_site_2 shown as "ned_site_2" at position 121! *** *** ERROR, MMTV-undefined-site shown as "-undefined-site" at position 126! *** . *** ERROR, GR-intron-site-2 shown as "tron-site-2" at position 182! *** .... *** ERROR, p300-consensus shown as "0-consensus" at position 422! *** ... *** ERROR, c-myc_responsive_region shown as "myc_responsive_region" at position 612! *** ... *** ERROR, CAAT_site(1) shown as "AT_site(1)" at position 781! *** ....... .. MAP complete with: Sequence Length: 1,144 Enzymes Chosen: 4,920 Cutsites found: 162 CPU time: 04.96 Output file: z18853.map gcg2 5% more z18853.map (Linear) MAP of: z18853.gb_in1 check: 4598 from: 1 to: 1144 LOCUS CECPASMR 1144 bp mRNA INV 10-MAR-1994 DEFINITION C.elegans mRNA for capping protein alpha subunit. ACCESSION Z18853 VERSION Z18853.1 GI:6687 KEYWORDS capping protein alpha subunit. SOURCE Caenorhabditis elegans. . . . Using Enzyme data from: enzyme.dat FileCheck: 2714 Note that some entries in this file are prefixed by ;. These entries have recognition sites which are very common and therefore by default these entries are not included in the search (according to David Ghosh these are entries for which N_PROB > 5.0e-04). If you wish your search to include these entries, specify /ENZ=** (VMS) or -enz=** (UNIX) on the command line of any of the mapping programs (MAP, MAPLOT, or . . . With 4920 enzymes: * November 6, 2000 20:36 .. GRE_CS8 GRE_CS7 EcR-consensus_(2) abaA-consensus |ATF_CS2| H4TF-1hist | D9 | | || | | | AGTTTGAGAATGTCGGAGATCAGTGACGCCGAAAAGGTCCGCATTGCTTCGGATTTCATT 1 ---------+---------+---------+---------+---------+---------+ 60 TCAAACTCTTACAGCCTCTAGTCACTGCGGCTTTTCCAGGCGTAACGAAGCCTAAAGTAA CNBP-SRE c-fos.5 | HSVIE | | CAP-box TAATGARAT | | HSF-consensus | pha-TIF_CS | | c-Myb-c-myb | | | | | | | | AAACACGCGCCACCCGGCGAGTTCAACGAGGTATTCAATTCGGTTCGGATGCTTTTGGAA 61 ---------+---------+---------+---------+---------+---------+ 120 TTTGTGCGCGGTGGGCCGCTCAAGTTGCTCCATAAGTTAAGCCAAGCCTACGAAAACCTT GR-uteroglobin.1 GR-uteroglobin.2 CAP-box | -undefined-site | | GAL1-TATA ned_site_2 | | |EcR-consensus_(2) | | | | | | | AATGATGATCTTCTGAAGAACAAATGTGTTAATGCTATCGCTCAATATAACGTTGGACAA 121 ---------+---------+---------+---------+---------+---------+ 180 TTACTACTAGAAGACTTCTTGTTTACACAATTACGATAGCGAGTTATATTGCAACCTGTT OMP-undefined-site DTF-1_RS2 tron-site-2 | box_5 C/EBP_CS1 | | | | TTTGTGCCAGTAAAGTTGGATGGTGTTGCCAAGCAGACTCTGATCACTCCATACAATGAT 181 ---------+---------+---------+---------+---------+---------+ 240 AAACACGGTCATTTCAACCTACCACAACGGTTCGTCTGAGACTAGTGAGGTATGTTACTA AntP_CS E1A-F_CS | TFIID-MBP TFIID-MBP UCE.1 | | | | | TTGGGTAATGGACGTTTCTACGATGAAGTTTCAAAGAAAAGTTTCAAATACGATCACGTC 241 ---------+---------+---------+---------+---------+---------+ 300 AACCCATTACCTGCAAAGATGCTACTTCAAAGTTTCTTTTCAAAGTTTATGCTAGTGCAG T-antigen_RS c-mos_DS2 E1A-F_CS | MSP_CS | E1A-F_CS | | | | | CGTAAAGAGGCCGCAGATCTTCAACCACATCCAGCCGAGTCTGGAATAACCGAACAATGG 301 ---------+---------+---------+---------+---------+---------+ 360 GCATTTCTCCGGCGTCTAGAAGTTGGTGTAGGTCGGCTCAGACCTTATTGGCTTGTTACC AntP_CS TATA-box-CS | TATA-box-CS | | TATA-box-CS | | | element_II_rs-4 TFIID-MBP TATA-box-CS | | | | CCBF-CLN2 | ATF_CS2 | F5 | | | | |D2 | | | | | | | | | | | | | CGTCAAGCTCTTCAAACTCAACTCGATATATATATTGATGATCATTACGCGAAAAGTGGA 361 ---------+---------+---------+---------+---------+---------+ 420 GCAGTTCGAGAAGTTTGAGTTGAGCTATATATATAACTACTAGTAATGCGCTTTTCACCT OCTA3 MAT-OCTA1 IgNF-A-IgH_(2) Octa-U2snRNA Oct-R_CS Oct-4-consensus OCTA1.1 | MAT-OCTA2 | histone-H2B-US | OBF-histone | OBF-H2B1 | IgNF-A-IgH_(1) | IgHC.1 | NF-A1-IgHC | NF-A2-IgHC | IgHC.2 | IgHC.14 | IgHC.15 | IgHC.16 | IgNF-A-Igk | NF-A1-IgkLc | NF-A2-IgkLc | SEF4-consensus U5snRNA | 0-consensus | Ig-kappa.2 | | | | | ACGGGAGTGGTTTTTGCTCGAAACGGAGTTTTCACGATTTGCATCGAATCTCATCAATTC 421 ---------+---------+---------+---------+---------+---------+ 480 TGCCCTCACCAAAAACGAGCTTTGCCTCAAAAGTGCTAAACGTAGCTTAGAGTAGTTAAG AP-2_CS4 NF-1-betaM-globin F-ACT1_RS | abaA-consensus | | GR-intron-site-2 | | | TEF1-GTIIC | | | | enhancer_core_(1)| | | | | repressing_elements || | | | | CuE1.1 | || | | | | IgHC.20 | || | | | | | | || | | | | CAGCCAAAAAATTTCTGTAACGGAAGATGGCGTTCGGAGTGGAATGTGCCGGTTGGCGAT 481 ---------+---------+---------+---------+---------+---------+ 540 GTCGGTTTTTTAAAGACATTGCCTTCTACCGCAAGCCTCACCTTACACGGCCAACCGCTA PEA3_CS PEA3-uPA Elk-1-gamma-actin/_type_5_cyto histone_H4_CS.2 | AntP_CS | histone_H4_CS.2 | | C/EBP_CS1 | | | | | | | | GGTAAATCAGGATCTCAGGAGATGAAAGGAAAAATTTTGTCGCAAGTTCATTATTACGAA 541 ---------+---------+---------+---------+---------+---------+ 600 CCATTTAGTCCTAGAGTCCTCTACTTTCCTTTTTAAAACAGCGTTCAAGTAATAATGCTT uPA-undefined-site-5 GR-uteroglobin.1 | GR-uteroglobin.2 | myc_responsive_region | | E2A_CS| | | GCN4-ILV1.3 HC5 z18853.map (9%)