Chapter 1. Getting Started

Table of Contents

This chapter provides the basic information you need to get started working with SeqWeb.

Everyone should read the SeqWeb Requirements and Window Layout sections before proceeding.

If you are already familiar with a previous version of SeqWeb and you want to get into an analysis as quickly as possible, you may need only the Quick Start. Otherwise, we suggest you also walk through an Example Analysis to become familiar with the steps.

If you want or need more detailed information about using SeqWeb, see the Preface, which describes the organization of this document, or click on the Help icon to access online help.

SeqWeb Requirements

[Top | Next]

SeqWeb provides a simplified interface to a core set of Wisconsin Package sequence analysis programs. Within those programs, a core set of parameters are available for each program.

SeqWeb is installed on a server at your local site and administered by your local SeqWeb Administrator. This person determines which of the GCG-provided databases are installed at your site and sets up accounts for accessing SeqWeb.

You access SeqWeb from your desktop or laptop computer by using a web browser, such as Netscape or Internet Explorer.

To use SeqWeb Version 2.0, you must have:

Window Layout

[Previous | Top | Next]

The basic SeqWeb window layout is shown below. The two frames on the left are used for navigating throughout SeqWeb's functions. The large frame on the right is primarily for interacting with and running SeqWeb programs. Note that the bottom of the window contains a status line, as well as icons to access Technical Support and Online Help.

Note: A Netscape window is shown below and throughout this document. Internet Explorer windows are similar but not exactly the same.

SeqWeb Window Description

Once you select a program, the right frame displays content specific to that program (as shown below). Note that the top of the content frame contains a book icon, which provides access to online help specific to this program, and that the bottom of the frame contains an area for program-specific buttons.

SeqWeb Program Window Description

Quick Start

[Previous | Top | Next]

To use SeqWeb, follow these simple steps:

  1. Start your web browser.
    See Appendix A for web browser recommendations.

  2. Type the URL for your installation of SeqWeb in the browser window Location line.
    If you do not know the URL, check with your SeqWeb administrator.

  3. Log in to SeqWeb.
    If you do not have a user name and password, check with your SeqWeb administrator.

  4. Add the sequences you want to analyze.

  5. Select a program to run.

  6. In the program's Input Area:
    1. Choose one or more sequences.
    2. Set the program parameters.
    3. Click Run (or Run in Background).

  7. View the program results.

  8. Print and/or save the results to your local computer (optional).
    The file format for saving results is specified in your SeqWeb Preferences settings.

If you need additional help getting started with SeqWeb, walk through the Example Analysis below.

Example Analysis

[Previous | Top]

This example analysis walks you through the steps used to analyze a sequence with SeqWeb. It is intended to familiarize you with the SeqWeb interface and to get you working with your own sequence data quickly. This example uses Netscape for the browser, but the steps are basically the same if you are using Internet Explorer. The example begins with the assumption that you are already logged in to SeqWeb. If you need assistance in doing so, contact your SeqWeb administrator.

If you have not already done so, familiarize yourself with the basic SeqWeb window layout (described above) before starting the example.

Let's walk through an example session, step by step, using the MAP program to perform a restriction mapping on a DNA sequence:

  1. Click Contents in the upper left frame of the SeqWeb window.
    The lower left frame displays the SeqWeb programs grouped by function.
    (If you select Index, it groups them alphabetically.)

  2. Click Mapping from the list in the lower left frame of the SeqWeb window.
    The frame on the right displays the available mapping programs. Notice that you can choose to map a nucleic acid sequence or protein sequence.

  3. Select the Map program option to Display a restriction map of your nucleic acid sequence.
    The Map: Restriction Mapping page loads in the right frame. Notice the open book icon in the upper right corner. You can click on this icon to access the online help documentation that describes this program's function and parameters.

  4. Identify the sequence(s) you want to analyze.
    To run an analysis, you must specify which sequence(s) in the Input Sequence list that you want to analyze. If this is the first time you are using SeqWeb, your Input Sequence list will be empty. You will need to add the sequences that you want to work with.

  5. Add a sequence to analyze.
    You can add a sequence using one of the Add from buttons located below the Description field near the bottom of the Restriction Mapping page:

    For this example, we will create a new sequence using the Clipboard.

    1. Click Clipboard.
      An Add from Clipboard window appears.

    2. Type the following text into the specified fields:

      Name: test.seq

      Description Line: This is a test DNA sequence for SeqWeb.

      Reference: (leave blank)

      Sequence Data: gatcgatcgatcgatcgatcgatcgatcgatcgatcgatcgatcgatc

      The Add from Clipboard window should now look like this:

      Add from Clipboard window filled in

    3. Click OK.
      The Add from Clipboard window closes and test is added to the Input Sequence list.

    4. Select test in the Input Sequence list.
      Once you add sequences into SeqWeb, they should automatically appear in the program's Input Sequence list. (Click the Refresh button if it is not displayed in the list.)

      If you choose to run a program on a nucleic acid sequence, the Input Sequence list automatically displays only those nucleic acid sequences you had previously added into SeqWeb. Similarly, if you choose to run a program on a protein sequence, SeqWeb displays only previously added protein sequences.

      To select the sequence you want to analyze, simply click on it in the list.

  6. Review the program's parameters.
    Use the scroll bar on the right to scroll down the page and review the program's parameters. These parameters customize the way Map runs. Notice that each parameter has a link to online help. We won't modify any of the parameters for this example.

    Notice also that this program allows you to choose the enzyme set to be used for analysis. To select the enzymes to be used, click the View Chosen Enzymes button and the Enzyme Chooser window displays. For this example, we will leave the settings as is, so click the Close button at the bottom of the Enzyme Chooser window if you have opened it. (For more information about the Enzyme Chooser, click the book icon in the upper right corner of the Enzyme Chooser window.)

  7. Click Run to start the program run.
    The Map program normally requires just a few seconds to run. When finished, SeqWeb displays the Map results page.

    Warning: Some Wisconsin Package programs may take longer to complete their analyses. While you are waiting for an analysis to complete, do not click the Back button or move to another web page in that web browser window. This will cause the program to stop running.

  8. Review the program's results.
    If you click Run, the program results automatically display when the program is finished. If you click Run in Background, then you will need to use the Job Manager or Results Manager to access the results.

    Note that you can easily refine the program run from the results page if you want to run the analysis again with different parameter settings.

  9. Print the results (optional).
    If you want a paper copy of the results, use your browser program's File ... Print (or Print Preview, if available) function to print the Map results page. For this example, we're using Netscape's Print Preview function to first display how the Results page will print, then printing from there.

  10. Save the results to your local computer (optional).
    Program results are not automatically saved in SeqWeb. If you think you may want to keep a copy of the results, you should save them to your local computer. To do so, click the Save as HTML button at the bottom of the frame. If you are using Netscape, an Unknown File Type dialog box appears. Click the Save File... button, and a Save As... dialog box opens. From there, you can specify the saved file's name and location.

    Warning: Your SeqWeb output may have multiple files associated with it, so you should be cautious about renaming the files as you save them to your local computer. Output that includes multiple files contains links within each file to the other files associated with it. Therefore, renaming any of the files would break the links between them.